Skip to main content

Table 1 Primer sequences used for quantitative real-time polymerase chain reaction

From: Comparative study on saponin fractions from Panax notoginseng inhibiting inflammation-induced endothelial adhesion molecule expression and monocyte adhesion

gene name Forward primer
(5' to 3')
Reverse primer
(5' to 3')
PCR product size (bp) GeneBank
accession no.
ICAM-1 AGACACAAGCAAGAGAAGAA GAGAAGCCCAAACCCGTATG 234 NM_012967.1
VCAM-1 GGAGCCTGTCAGTTTTGAGAATG TTGGGGAAAGAGTAGATGTCCAC 105 NM_012889.1
GAPDH TGCACCACCAACTGCTTAG AGTGGATGCAGGGATGATGT 180 NM_017008