Skip to main content

Advertisement

Table 1 Universal primers for PCR amplification of commonly used DNA regions

From: Forensically informative nucleotide sequencing (FINS) for the authentication of Chinese medicinal materials

Region Primer (5' > 3') Reference
5S rDNA spacer S-1 GGATTCGTGCTTGGGCGAGAGTAGTA [34]
  AS-1 TGCGATCATACCAGCACTAAGGATCC  
12S rDNA Fwd CAAACTGGGATTAGATACCCCACTAT [35]
  Rev GAGGGTGACGGGCGGTGTGT  
16S rDNA Fwd CGCCTGTTTATCAAAAACAT [36]
  Rev CTCCGGTTTGAACTCAGATC  
18S rDNA 18SF CAACCTGGTTGATCCTGCCAGT [37]
  18SR CTGATCCTTCTGCACCTTCACCTAC  
COI LCO1490 GGTCAACAAATCATAAAGATATTGG [15]
  HCO2198 TAAACTTCAGGGTGACCAAAAAATCA  
Cyt b mcb398 TACCATGAGGACAAATATCATTCTG [38]
  Rev CCTCCTAGTTTGTTAGGGATTGATCG  
ITS ITS4 TCCTCCGCTTATTGATATGC [18]
  ITS5a CCTTATCATTTAGAGGAAGGAG  
ITS-1 18d CACACCGCCCGTCGCTCCTACCGA [39]
  5.8c TTGCGTTCAAAGACTCGATG  
ITS-2 5.8d AACCATCGAGTCTTTGAACGCA [39]
  28cc ACTCGCCGTTACTAGGGGAA  
MatK 3F_KIM f CGTACAGTACTTTTGTGTTTACGAG [19]
  1R_KIM r ACCCAGTCCATCTGGAAATCTTGGTTC  
Mitochondrial control region L15998 TACCCCAAACTCCCAAAGCTA [40]
  CSBDH TGAATTAGGAACCAGATGCCAG  
TrnH-psbA psbA3'f GTTATGCATGAACGTAATGCTC [18]
  trnHf CGCGCATGGTGGATTCACAATCC  
TrnL-trnF Tab C CGAAATCGGTAGACGCTACG [41]
  Tab F ATTTGAACTGGTGACACGAG  
RbcL rbcLa_F ATGTCACCACAAACAGAGACTAAAGC [19]
  rbcLa_R GTAAAATCAAGTCCACCRCG