Skip to main content

Table 3 Candidate primer pairs for species-specific identification of the target DNAs

From: PlantID – DNA-based identification of multiple medicinal plants in complex mixtures

Forward primer name Sequence 5′ to 3′ Tm Reverse primer name Sequence 5′ to 3′ Tm Amplicon length (bp)
Hand F 1 2 ACATCGTCGCCCCAAACC 67.0 Hand R 1 2 CCATTATCCGCCCCATCCTC 66.5 65
Hand F 1 3 AAATGTGATACTTGGTGTGAATTGC 64.7 Hand R 1 3 CGAGGTGTTGGGTTTGGG 64.8 135
Hand F 1 4 CACATCGTCGCCCCAAAC 65.6 Hand R 1 4 ACCATTATCCGCCCCATCC 65.9 67
Hand F 1 4 CACATCGTCGCCCCAAAC 65.6 Hand R 1 5 TTATCCGCCCCATCCTCTTC 65.4 63
Hand F 1 5 CGGCTGTCCTCCTGTTCATAAC 67.1 Hand R 1 6 TCACACCAAGTATCACATTTCGCTAC 67.3 98
Hand F 2 1 CGAAATGTGATACTTGGTGTGAATTG 65.1 Hand R 1 3 CGAGGTGTTGGGTTTGGG 64.8 137
Hasc F 1 2 TTCCTTCGGTTCATAACTAAAAC 60.9 Hasc R 1 2 ACCCAATGAACTCGAAAGAG 61.7 225
Hasc F 1 4 GTGGCTTTCCTTCGGTTC 62.5 Hasc R 1 2 ACCCAATGAACTCGAAAGAG 61.7 231
Hasc F 1 3 TTTCCTTCGGTTCATAACTAAAAC 61.5 Hasc R 1 1 GAACTCGAAAGAGGCATTG 60.4 219
Hasc F 1 5 TCCTTCGGTTCATAACTAAAAC 60.2 Hasc R 1 1 GAACTCGAAAGAGGCATTG 60.4 217
Hath F 1 1 CCCCGAAATTCCGATATCTC 61.8 Hath R 1 1 CTTACAACCACCGCTAGTC 61.7 137
Hath F 1 1 CCCCGAAATTCCGATATCTC 61.8 Hath R 1 3 CAACCACCGCTAGTCGTG 64.6 133
Hath F 1 1 CCCCGAAATTCCGATATCTC 61.8 Hath R 1 4 CCGCTAGTCGTGGCTTTG 64.9 127
Hath F 1 3 GTGTCACACATCGTTGCC 63.2 Hath R 1 3 CAACCACCGCTAGTCGTG 64.6 151
Hper F 1 1 TGTAACGCTCCCGGCTGTG 69.0 Hper R 1 1 CCGATTGTCTCTTGCGAGATATC 65.0 273
Hper F 4 1 GGGGCTTCCTTCTGTTCATAAC 65.1 Hper R 4 1 TCTTGCGAGATATCGGGATTTTG 64.9 222
Hper F 1 2 ATAAGAAGTGTAACGCTCCCGGCTGTG 72.5 Hper R 1 1 CCGATTGTCTCTTGCGAGATATC 65.0 281
Hper F 1 3 GAAGTGTAACGCTCCCGGCTGTG 71.9 Hper R 1 1 CCGATTGTCTCTTGCGAGATATC 65.0 277
Hper F 1 4 AGTGTAACGCTCCCGGCTGTG 71.2 Hper R 1 1 CCGATTGTCTCTTGCGAGATATC 65.0 275
  1. The selected pairs are indicated in bold. Candidate selection was based on specificity, and further analysis of theoretical interactions in the multiplex PCR and discrimination of amplicons by capillary electrophoresis were used to make the final selection.