Skip to main content

Advertisement

Table 1 Primers used for the PCR analyses

From: Protective effect of Phellinus linteus polysaccharide extracts against thioacetamide-induced liver fibrosis in rats: a proteomics analysis

Gene Primer sequence (5’-3’) Fragment size (bp) Annealing temperature (°C)
Preprohaptoglobin F1: TGCCTATCTGCCTGCCTTC 316 58
R2: GTGTCCTCCTCCGTGTCAT
Hemopexin F: AAGCCAGACTCAGATGTAA 479 55
R: AAGCAGTAGTAGCGTTCA
Gsta4 F: GGACCTGATGATGATGATTATC 446 54
R: TATCTTGCCTCTGGAATGC
Bckdha F: AGCGTCACTTCGTCACCATT 547 60
R: GCCTTCTCCTGTTCCTCATCC
Bhmt F: CAGACACCTTCCTACCTCAG 281 52
R: CAGTTCACACCGACAATGG
Dhfr F: CTTGACGGCACTCTAAGC 304 52
R: CTCCTTGTGGTGGTTCCT
Qdpr F: GATGTGGTGGAGAATGAAGAGG 241 56
R: AGTGGCTAGAGATGGTGGATG
Gapdh F: CATGACCACAGTCCATGCCATC 451 60
R: CACCCTGTTGCTGTAGCCATATTC
Uk114 F: GCATGTCGTCAATAATCAGA 443 54
R: CTCCAGAGTCAGCATCAG
Tft F: GGTTCATCAGGTGCTCTATCG 311 58
R: CCAGGTCGTCTCCATCGTATA
Ubiquitin C F: TGGAGGTCGAGCCCAGTGTTA 105 58
R: CCCAAGAACAAGCACAAGAAGGGCT
  1. 1F: Forword.
  2. 2R: Reverse.