Skip to main content

Table 1 Sequences of oligonucleotide primers used for real-time PCR

From: Effects of a novel curcumin derivative on insulin synthesis and secretion in streptozotocin-treated rat pancreatic islets in vitro

Gene Primer sequence
Insulin Forward primer: 5′- TCACACCTGGTGGAAGCTTC-3′
Reverse primer: 5′- ACAATGCCACGCTTCTGC -3′
JNK Forward primer: 5′- AAGCAGCAAGGCTACTCCTTCTCA-3′
Reverse primer: 5′- ATCGAGACTGCTGTCTGTGTCTGA-3′
PDX-1 Forward primer: 5′-GGATGAAATCCACCAAAGCTC -3′
Reverse primer: 5′- TTCCACTTCATGCGACGGT -3′
GLUT-2 Forward primer: 5′- CAAGATCACCGGACCTTGG -3′
Reverse primer: 5′- ATTCCGCCTACTGCAAAGCT -3′
GLP-1 Forward primer: 5′- ACCTTCACCAGCGACGTAAG -3′
Reverse primer: 5′- TCCTTTTACAAGCCAAGCGA – 3′
TCF7L2 Forward primer: 5′- CCGCCCGAACCTCTAACAAA - 3′
Reverse primer: 5′ - TCAGTCTGTGACTTGGCGTC - 3′
HO-1 Forward primer: 5′- CTGTTGGCGACCGTGGCAGT – 3′
Reverse primer: 5′- CTGGGCTCAGAACAGCCGCC – 3′
β-Actin Forward primer: 5′-CCTTCCTGGGCATGGAGTCCT-3′
Reverse primer: 5′- GGAGCAATGATCTTGATCTTC-3′