Skip to main content

Advertisement

Table 1 Information on the primers used for real-time PCR

From: Lignans from the bark of Eucommia ulmoides inhibited Ang II-stimulated extracellular matrix biosynthesis in mesangial cells

Gene Primers Product size (bp)
AR F: TCCCAGGATCAAGGAAATTG 202
R: ACAACAGGAACTGGAGGGTG
FN F: AACGGCCCTGGTTTGTACC 285
R: CTCCAACATATAGCCACCAGTC
Col I F: GAGAGAGCATGACCGATGGA 251
R: CGTGCTGTAGGTGAATCGAC
Col III F: GGCTGCACTAAACACACTGG 229
R: TGGTTGACGAGATTAAAGCAAG
Col IV F: TGTCAGCAATTAGGCAGGTC 205
R: CACCATGTTTCGGAATGGTT
GAPDH F: CAAGTTCAACGGCACAGTCAAG 123
  R: ACATACTCAGCACCAGCATCAC