Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers used for PCR amplification and sequencing

From: Identification of constituent herbs in ginseng decoctions by DNA markers

Herbal species Primer pair Primer name Direction Primer sequence (5′ to 3′) Amplicon size (bp) Annealing temperature (°C) Gene or spacer region
A. carmichaeli 1 Aca_F1 Forward GGTGCATGTCTGGCTTAG 148 66 trnH-psbA
A. macrocephala 2 Ama_F1 Forward CGACCCGCGAACATGTAAC 108 56 ITS2
G. uralensis 3 Gur_F1 Forward ACAGACCGTTGCCCGAC 106 57 ITS2
P. ginseng 4 Pgi_F1 Forward GGCAGTTGGCTAATGAAAGGTTGTA 88 64 26S-18S
  5 Pgi_F2 Forward TGAAAGGTTGTAATAGTTT 249 48 26S-18S
  6 Pgi_F3 Forward ACGGTTGCTTTTCCATCATTGTGT 311 64 26S-18S
  7 Pgi_SPF1 Forward TGTCGGGCAAGGCCAAAAATG 121 64 26S-18S
  8 Panax_F1 Forward GGTGCTTTGAGTGCTGCTGA 121 and 191 64 26S-18S
P. ginseng, P. quinquefolius 9 Panax_F1 Forward GGTGCTTTGAGTGCTGCTGA 191 64 26S-18S
Z. officinale 10 Zof_F1 Forward GTAAAAGTCGGCAGTCGC 106 65 ITS2