Skip to main content

Advertisement

Table 1 Primer sequences used for real-time PCR

From: Crude triterpenoid saponins from Ilex latifolia (Da Ye Dong Qing) ameliorate lipid accumulation by inhibiting SREBP expression via activation of AMPK in a non-alcoholic fatty liver disease model

Genes Primer sequences Length
HMGCS Forward (5′-3′) GCCGTGAACTGGGTCGAA 77 bp
Reverse (5′-3′) GCATATATAGCAATGTCTCCTGCAA
ACC Forward (5′-3′) TGAAGGGCTACCTCTAATG 182 bp
Reverse (5′-3′) TCACAACCCAAGAACCAC
SCD-1 Forward (5′-3′) CCGGAGACCCCTTAGATCGA 190 bp
Reverse (5′-3′) TAGCCTGTAAAAGATTTCTGCAAACC
SREBP-2 Forward (5′-3′)GCGTTCTGGAGACCATGGA 131 bp
Reverse (5′-3′) ACAAAGTTGCTCTGAAAACAAATCA
SREBP-1c Forward (5′-3′)TGTTGGCATCCTGCTATCTG 189 bp
Reverse (5′-3′) AGGGAAAGCTTTGGGGTCTA
FAS Forward (5′-3′) GCTGCGGAAACTTCAGGAAAT 84 bp
Reverse (5′-3′) AGAGACGTGTCACTCCTGGACTT
GAPDH Forward (5′-3′) AGGTCGGTGTGAACGGATTTG 123 bp
Reverse (5′-3′) TGTAGACCATGTAGTTGAGGTCA