Skip to main content

Table 1 Information for LAMP primers

From: Differentiation of deer tendons from cattle tendons by a loop-mediated isothermal amplification (LAMP) test and bone remodeling bioassays

Primer Sequence (5′ to 3′ direction) Internal control Specific LAMP
F3 TTTGGTCCCAGCCTTCCT  
B3 GCGGCTGGCACGA
FIP TGTGTGCTTGATACCAGCTCCTCTAGCATCCACACCCCAGTGA  
BIP CCTTGCATAGCCACACCCCCTCAAACTTTCGTTTATGGCTTAATTTTT  
F3-S CAGCCTTCCTATTGACC  
FIP-S GGATGTGTGCTTGATACCAGCTCCGCATCCACACCCCAGTGAA  
BIP-S ACCTTGCATAGCCACACCCCCAAACTTTCGTTTATGGCTTAATTTTTA