Chi-Ju-Di-Huang-Wan protects rats against retinal ischemia by downregulating matrix metalloproteinase-9 and inhibiting p38 mitogen-activated protein kinase

Table 1 Sequences of oligonucleotide primers and details of polymerase chain reactions

mRNA	Primers (5′→3′)	Bases in base pairs	Product size	Cycles profile	Cycles number
mRNA	Primers (5′→3′)	Bases in base pairs	Product size	Denaturation/annealing/extension (temperature and time in seconds)	Cycles number
β-actin	F: AGGGAAATCGTGCGTGACAT	694–713	150	95/95/60 °C (20/3/30 s)	40
β-actin	R: GAACCGCTCATTGCCGATAG	824–843	150	95/95/60 °C (20/3/30 s)	40
Thy-1	F: ACCAAGGATGAGGGCGACTA	380–399	120	95/95/60 °C (20/3/30 s)	40
Thy-1	R: CAGGCTTATGCCACCACACTT	479–499	120	95/95/60 °C (20/3/30 s)	40
MMP-9	F: TGCGCTGGGCTTAGATCATT	1218–1237	105	95/95/60 °C (20/3/30)	40
MMP-9	R: TGGATGCCTTTTATGTCGTCTTC	1300–1322	105	95/95/60 °C (20/3/30)	40

ISSN: 1749-8546