Skip to main content

Advertisement

Table 1 Sequences of oligonucleotide primers and details of polymerase chain reactions

From: Chi-Ju-Di-Huang-Wan protects rats against retinal ischemia by downregulating matrix metalloproteinase-9 and inhibiting p38 mitogen-activated protein kinase

mRNA Primers (5′→3′) Bases in base pairs Product size Cycles profile Cycles number
Denaturation/annealing/extension (temperature and time in seconds)
β-actin F: AGGGAAATCGTGCGTGACAT 694–713 150 95/95/60 °C (20/3/30 s) 40
R: GAACCGCTCATTGCCGATAG 824–843
Thy-1 F: ACCAAGGATGAGGGCGACTA 380–399 120 95/95/60 °C (20/3/30 s) 40
R: CAGGCTTATGCCACCACACTT 479–499
MMP-9 F: TGCGCTGGGCTTAGATCATT 1218–1237 105 95/95/60 °C (20/3/30) 40
R: TGGATGCCTTTTATGTCGTCTTC 1300–1322
  1. F forward; R reverse