Skip to main content

Table 2 Nucleotide sequences of the primers used for real-time PCR

From: Jiangtang decoction ameliorate diabetic nephropathy through the regulation of PI3K/Akt-mediated NF-κB pathways in KK-Ay mice

  Forward nucleotide sequence 5′–3′ Reverse nucleotide sequence 5′–3′
IRS-1 GGCAGCAATGAGGGCAACT TGGAAGCTGATGCTGGCATA
IL-6 GTTGCCTTCTTGGGACTGAT GCCATTGCACAACTCTTTTCT
TNF-α GCCATTGCACAACTCTTTTCT AGTTGGTCCCCCTTCTCC
ICAM-1 GCTTCACACTTCACAGTTACTT AGAGGACCTTAACAGTCTACAAC
PI3K CGGCGTGACATGTAGGCTCTCA ACGGCCCGCACTGTAACCTAT
Akt TGTGACCATGAACGAGTTTGA GTCGTGGGTCTGGAATGAGTA
IKKβ TGCTGCCCAAGGTAGAAGAGGTAG AGGCACTGGAAGGCTGGGACATTA
NF-κB CACCTCACCGGCCTCATCCACA AGTCCCCGCGCTGCTCCTCTAT
GAPDH GGTGGAGCCAAAAGGGTCAT CGTGGTTCACACCCATCACA