Skip to main content

Table 1 Sequences of oligonucleotide primers and products size of RT-qPCR

From: Wenyang Huazhuo Tongluo formula inhibits fibrosis via suppressing Wnt/β-catenin signaling pathway in a Bleomycin-induced systemic sclerosis mouse model

mRNA Primers (5′ → 3′)
F: Forward
R: Reverse
Product size (bp)
Wnt1 F: TGTTGACGGATTCCAAGAGT
R: GAAGTAGACGAGGTCGTGAG
235
β-catenin F: GGCAACCCTGAGGAAGAAGA
R: AGCGTCAAACTGCGTGGAT
192
DKK1 F: ATCAATTCCAACGCGATCAA
R: GGTCAGAGGGCATGCATATT
325
GSK3β F: CCTGGTGCTGGACTATGT
R: CAAGAGGTTCTGTGGTTTAA
214
TCF4 F: ACCACATGACTAGCAGGGATCT
R: GGAGGAACTTTTCGGACTTTCT
298
VEGF F: TTACTGCTGTACCTCCACC
R: ACAGGACGGCTTGAAGATG
189
cyclin D1 F: GAGAAGTTGTGCATCTACAC
R: GAAGGGCTTCAACTGTTCC
375
Survivin F: GCTCTATGTAAGATCGCTTC
R: CGTGAATCGCCATAATTATCC
389
CTGF F: GTGTGTGACGAGCCCAAGGA
R: AGTTGGGTCTGGGCCAAATGT
112
Fn1 F: ACCATACCTGCCGAATGTAG
R: CTCCTCTCCAATGGCGTAAT
439
Collagen I F: TGTTCGTGGTTCTCAGGGTAG
R: TTGTCGTAGCAGGGTTCTTTC
245
Collagen III F: TGCCCACAGCCTTCTACACCT
R: CAGCCATTCCTCCCACTCCAG
254
GAPDH F: TGGGTGTGAACCACGAGAA
R: GGCATGGACTGTGGTCATGA
143