Skip to main content

Tabel 1 Sense and antisense primer sequences of Eotaxin, Bcl-2, Fas, FasL and GAPDH

From: Wentong decoction cures allergic bronchial asthma by regulating the apoptosis imbalance of EOS

Equipment name Primer sequence (5′–3′) Product size (bp)
GAPDH upstream primer CCTTCCGTGTTCCTACCCC 131
GAPDH downstream primer GCCCAGGATGCCCTTTAGTG
Eotaxin upstream primer GCTACAAAAGAATCACCAACAACAG 95
Eotaxin downstream primer CTTTTTCTTGGGGTCAGCACAG
Bcl-2 upstream primer GGGCTACGAGTGGGATACTGGAG 101
Bcl-2 downstream primer CGGGCGTTCGGTTGCTCT
Fas upstream primer ATCAATAATCATGGCTGTGT 116
Fas downstream primer TATTTGAGTGTATCCCTGCT
FasL upstream primer GGTGCTGGTGGCTCTGGTT 142
FasL downstream primer TGTGCTGGGGTTGGCTATTT