Skip to main content

Advertisement

Table 2 Primers for amplification and sequencing

From: Effective authentication of Placenta Hominis

Species specificity Primer name Sequence (5′–3′) Amplicon size (bp) Annealing temp. (°C)
Homo sapiens COI_human_F GCAACCTTCTAGGTAACGACCAC 120 63
COI_human_R GGGGAACTAGTCAGTTGCCAAAG
Bos taurus COI_cow_F CGACCAAATCTACAACGTAG 102 61
COI_cow_R GGAACAAGTCAGTTACCG
Cervus elaphus and Cervus nippon COI_deer_F CTGCTTGGAGATGACCAAATT 125 59
COI_deer_R CCAATTATTAGGGGAACTAGTCAA
Ovis aries COI_sheep_F GGCAACTGACTAGTTCCT 117 59
COI_sheep_R CATAGAGGATGCTAGGAGTAAC