Skip to main content

Table 2 Primers for amplification and sequencing

From: Effective authentication of Placenta Hominis

Species specificity Primer name Sequence (5′–3′) Amplicon size (bp) Annealing temp. (°C)
Cervus elaphus and Cervus nippon COI_deer_F CTGCTTGGAGATGACCAAATT 125 59
Ovis aries COI_sheep_F GGCAACTGACTAGTTCCT 117 59