Skip to main content

Table 2 Primers used for RT-qPCR studies

From: Effects of Xinjiaxiangruyin on the TLR7 pathway in influenza virus-infected lungs of mice housed in a hygrothermal environment

Gene Forward (5′ to 3′) Reverse (5′ to 3′)
FM1 GACCAATCCTGTCACCTCTGAC AGGGCATTNTGGACAAAGCGTCTA
TLR7 GGGTCCAAAGCCAATGTG TGTTAGATTCTCCTTCGTGATG
MyD88 CGATTATCTACAGAGCAAGGAATG ATAGTGATGAACCGCAGGATAC
NF-κB ATTCTGACCTTGCCTATCTAC TCCAGTCTCCGAGTGAAG
GAPDH CTGAGCAAGAGAGGCCCTATCC CTCCCTAGGCCCCTCCTGTT