Skip to main content

Table 2 Primers for PCR amplification and sequencing

From: Specific DNA identification of Pheretima in the Naoxintong capsule

Primer name Sequence (5′ → 3′) Amplicon size (bp) Annealing temperature (°C)
Universal primers of COI [22]
 LCO1490 GGTCAACAAATCATAAAGATATTGG 650 40
 HCO2198 TAAACTTTCAGGGTGACCAAAAAATCA
MF2R2
 COI Metaphire F2 TTAGTGTCGTCCGCCGCAGTT 232 58
 COI Metaphire R2 CTACTGCCCACACAAATAGTGGG
AF3R1
 COI AA F3 TTTGGAAACTGACTGCTCCCA 247 55
 COI AA R1 CTAAAATTGATGAGGCACCC