Skip to main content

Table 2 Rat primer sequences of target genes

From: Topical application of Chinese herbal medicine DAEP relieves the osteoarthritic knee pain in rats

PrimerForward/ReverseSequence (5′ to 3′)
IL-6ForwardATCTGCCCTTCAGGAACAGC
ReverseAGCCTCCGACTTGTGAAGTG
TNF-αForwardCAGCCGATTTGCCATTTCATAC
ReverseGGCTCTGAGGAGTAGACGATAA
iNOSForwardCTCAGGCTTGGGTCTTGTTAG
ReverseTGTTGTTGGGCTGGGAATAG
COX-2ForwardTCTCCAACCTCTCCTACTACAC
ReverseCTCCACCGATGACCTGATATTT
MMP-3ForwardGGACCAGGGATTAATGGAGATG
ReverseCAGGGTCCAGAGAGTTAGATTTG
GAPDHForwardCAACGACCCCTTCATTGACC
ReverseCGCCAGTAGACTCCACGACAT