Skip to main content

Table 2 Primer sequences for RT-PCR

From: Jowiseungki decoction affects diabetic nephropathy in mice through renal injury inhibition as evidenced by network pharmacology and gut microbiota analyses

Primers Accession no. Sequence (5′–3′)
PKC-α
 Forward NM_011101.3 CCCATTCCAGAAGGAGATGA
 Reverse NM_011101.3 TTCCTGTCAGCAAGCATCAC
α-SMA
 Forward XM_006526606.2 ACTGCCGAGCGTGAGATTGT
 Reverse XM_006526606.2 TGATGCTGTTATAGGTGGTTTCG
TGF-β1
 Forward NM_011577.2 CGAAGCGGACTACTATGCTAAAGAG
 Reverse NM_011577.2 TGGTTTTCTCATAGATGGCGTTG
GAPDH
 Forward XM_017321385.1 CAGCCTCGTCCCGTAGACA
 Reverse XM_017321385.1 CGCTCCTGGAAGATGGTGAT