Skip to main content

Table 1 The primers in the experiment

From: The mediatory role of Majie cataplasm on inflammation of allergic asthma through transcription factors related to Th1 and Th2

Primers Primer sequence
β-acting Forward: CGTAAAGACCTCTATGCCAA
Reverse: TTGATCTTCATGGTGCTAGG
GATA-3 Forward: CTCGGCCATTCGTACATGGAA
Reverse: GGATACCTCTGCACCGTAGC
STAT6 Forward: CACATTTTGGCAGTGGTTTG
Reverse: CTGGCTCATTGAGGAGAAGG
T-bet Forward: GGTGTCTGGGAAGCTGAGAG
Reverse: GAAGGACAGGAATGGGAACA