Skip to main content

Table 1 Primer sequences used for qRT-PCR

From: Identification of drug targets and potential molecular mechanisms for Wantong Jingu Tablet extract in treatment of rheumatoid arthritis: bioinformatics analysis of fibroblast-like synoviocytes

Gene Primer Sequence (5′→3′)
BUB1 Forward AGCCCAGACAGTAACAGACTC
Reverse GTTGGCAACCTTATGTGTTTCAC
THOC1 Forward GAAAAATGAAGGTTGCCCAAGTT
Reverse TTGTCTCTGATTTACAGGCTTCC
SMC3 Forward AACATAATGTGATTGTGGGCAGA
Reverse TCCTTTTTGGCACCAATAACTCT
STAG2 Forward TCCTTCTGGTCCAAACCGAAT
Reverse ACCGACTGCATAGCACTCTTG
ORC4 Forward AGATTTTCTCACCGGCAGATACA
Reverse AGCAAGCATCAATAGCATGTGT
TTK Forward TCATGCCCATTTGGAAGAGTC
Reverse CCACTTGGTTTAGATCCAGGC
ATR Forward TCCCTTGAATACAGTGGCCTA
Reverse TCCTTGAAAGTACGGCAGTTC
BRCA1 Forward GAAACCGTGCCAAAAGACTTC
Reverse CCAAGGTTAGAGAGTTGGACAC
EIF3A Forward ACTCAGGATCGTACTGACAGATT
Reverse ATGGTACAGGCGCTCTACTCT
PNN Forward CTGGTCCTGGTGGAGGTAGA
Reverse TGTGCGCTCTTTGGAGGTAG
GAPDH Forward GGAGCGAGATCCCTCCAAAAT
Reverse GGCTGTTGTCATACTTCTCATGG