Skip to main content

Table 1 The sequence of primers for real-time PCR

From: The protective effects of liguzinediol on congestive heart failure induced by myocardial infarction and its relative mechanism

Gene name Primer sequence (5′-3′)
TGF-β1 Sense: CCTGGAAAGGGCTCAACAC
Antisense: CAGTTCTTCTCTGTGGAGCTGA
Smad2 Sense: CAGGACGATTAGATGAGCTTGA
Antisense: CCCCAAATTTCAGAGCAAGT
Smad3 Sense: CCTGCCACTGTCTGCAAG
Antisense: GCAGCAAATTCCTGGTTGTT
Smad7 Sense: ACCCCCATCACCTTAGTCG
Antisense: AAATCCATCGGGTATCTGGA
CD105 Sense: TGGGAGGCTAGGACTCAAGA
Antisense: TTGTGCTAGTCAAGGTGAGGAG
GAPDH Sense: TGTTGCCATCAACGACCCCTT
Antisense: CTCCACGACATACTCAGCA