Skip to main content

Table 1 Primer used for qPCR

From: Systemic osteoprotective effects of Epimedii Folium and Ligustri Lucidi Fructus in senile osteoporosis rats by promoting the osteoblastogenesis and osteoclastogenesis based on MLP-ANN model

Primer Upstream Downstream Product size
RANKL GCAGCATCGCTCTGTTCCTGTA GCATGAGTCAGGTAGTGCTTCTGTG 164 bp
M-CSF GAATGACTGAACCTGCCTGCTGAA AGGCCAGCTCAGTGCAAGAA 117 bp
Wnt5a ACAGGCAGTGGCATGCAGA CAGGCAGCTGTTGACCTAGGAA 134 bp
Atp6v0d2 CGAGGCATTCTACAAATTCTGCAA TTCAGTGCCAAATGAGTTCAGAGTG 124 bp
OPG CTCATCAGTTGGTGGGAATGAAGA ACCTGGCAGCTTTGCACAATTA 107 bp
IGF-1 GCACTCTGCTTGCTCACCTTTA TCCGAATGCTGGAGCCATA 148 bp
TGF-β1 CATTGCTGTCCCGTGCAGA AGGTAACGCCAGGAATTGTTGCTA 103 bp
BMP2 ACCGTGCTCAGCTTCCATCAC CTATTTCCCAAAGCTTCCTGCATTT 170 bp
β-actin CACTTTCTACAATGAGCTGCG CTGGATGGCTACGTACATGG 129 bp
  1. RANKL nuclear factor-kappa B ligand, M-CSF macrophage colony-stimulating factor, Atp6v0d2 d2 isoform of vacuolar (H +) ATPase, OPG osteoprotegerin, IGF-1 insulin-like growth factor-1, TGF-β1 transforming growth factor-β1, BMP2 bone morphogenetic protein-2