Skip to main content

Table 2 Primer information

From: Hepatoprotective effect of Qushihuayu formula on non-alcoholic steatohepatitis induced by MCD diet in rat

Target genes Forward sequence 5′-3′ Reverse sequence 5′-3′
PPAR-γ CCCTGGCAAAGCATTTGTAT ACTGGCACCCTTGAAAAATG)
β-actin AGCCATGTACGTAGCCATCC CTCTCAGCTGTGGGTGGTGAA
FOXA3 GACTCATGCCAAACCACCTT TCATTGAAGGACAGCGAGTG
HNF1A CAGCCACAACCATTCACATC GCCATCTGGGTGGATAAA
HNF4A AAATGTGCAGGTGTTGACCA CACGCTCCTCCTGAAGAATC
  1. cDNA and mRNA sequences were searched from KEGG or NCBI and primers were design by the NCBI primer designer