Skip to main content

Table 1 The gene-specific primers

From: Marchantia polymorpha L. ethanol extract induces apoptosis in hepatocellular carcinoma cells via intrinsic- and endoplasmic reticulum stress-associated pathways

Gene Primer sequences (5′–3′)
GAPDH F: AGCCTCGTCCCGTAGACA R: CTCGCTCCTGGAAGATGG
Srp72 F: GAGGGGTCGACATTGCTCTC R: GCCAGTTAAAGACCTCCCCC
Srp14 F: GCAAACCAGCACAGTGACAG R: ACAACTAGCCCAAGCCCATC
Srprb F: TCAGCTCCTGTTGTGTCACC R: ATGCAGCGATCTGTAGGCTC
Srpr F: AGAGCCTTGGCTGACCATTC R: GCCAGTACCCACAAAGACGA
Srp68 F: CCAAACAAGCCAACCTCGTG R: TGCCCTTGATGTAGCCTGTG
Srp19 F: TGCTCAGCAGTTGGACTGAAT R: TTGCTGAAGACTTGGGTCGG
Wfs1 F: GGAAACTAACATGGCCCGGA R: TCCAATCGCCCAGGAAGAAC
Atf6 F: AAGGGTCAACCAGGGATACG R: AAACACCCACAAGCCACAGG
Gadd34 F: GAGAAGACCAAGGGACGTGG R: TCGATCTCGTGCAAACTGCT
Hspa5 F: GTGTGTGAGACCAGAACCGT R: TAGGTGGTCCCCAAGTCGAT
Rpl22l1 F: ATGGCGCCGCAGAAAGACA R: GACCACACGTAGCCAATCACG
Rps29 F: AGCCGACTCGTTCCTTTCTC R: TTCAGCCCGTATTTGCGGAT
Rpl13a F: CGGCTGAAGCCTACCAGAAA R: GGAGTCCGTTGGTCTTGAGG
Cyclin B1 F: AAGGCCAAGGTCAGTATGGC R: CTCAGGCTCAGCAAGTTCCA
Cyclin D1 F: AGGCAGCGCGCGTCAGCAGCC R: TCCATGGCGCGGCCGTCTGGG
Cdk2 F: CACAGGGCTTGCACGTCACT R: TGTCTCCTGGCCTGCATCAC
Ddit3 F: GCAGCGACAGAGCCAGAATA R: ATGTGCGTGTGACCTCTGTT
Cdc25b F: ATCCTTACCAGTGAGGCTGC R: CTCTGGAAGCGCACATTCTC
Mcm4 F: CAAGGTTCAACCAGGGGACA R: ATGCAGACGTTTTGCATCCG
Mcm2 F: AGAAGTTCAGCGTCATGCGGAGTA R: CCCAAAGCGGTTGCGTTGATATGT
Cdk1 F: AAGTGTGGCCAGAAGTCGAG R: AAAGTACGGGTGCTTCAGGG
Gadd45α F: CTGCAGAGCAGAAGACCGAA R: GCAGGCACAGTACCACGTTA
Bax F: GCCTCCTCTCCTACTTC R: CCTCAGCCCATCTTCTT
Bcl-2 F: CACTTGCCACTGTAGAGA R: GCTTCACTGCCTCCTT