Skip to main content

Table 1 qPCR primer sequence

From: A network pharmacology approach to reveal the pharmacological targets and biological mechanism of compound kushen injection for treating pancreatic cancer based on WGCNA and in vitro experiment validation

Gene   5' to 3'
AKT1 Forward TCTATGGCGCTGAGATTGTG
Reverse CTTAATGTGCCCGTCCTTGT
CDK1 Forward TAGGCGGGATCTACCATACCC
Reverse TCATGGCTACCACTTGACCTG
EGFR Forward TGTGCCCACTACATTGACGG
Reverse TAGGCCCATTCGTTGGACAG
JAK1 Forward AGGGGATGGACTATTTGGGTTCTC
Reverse CCTTATCGGTTTCAATTGCTTTGG
MAPK1 Forward GGAACTATTTGCTTTCTCTTCC
Reverse CTACTTCAATCCTCTTGTGTGG
MAPK3 Forward ATCAACACCACCTGCGACCTTA
Reverse TACCAGCGCGTAGCCACATACT