Skip to main content

Table 2 The list of prisms used in RT-PCR for mRNA expression

From: Ginkgo biloba leaf extract mitigates cisplatin-induced chronic renal interstitial fibrosis by inhibiting the epithelial-mesenchymal transition of renal tubular epithelial cells mediated by the Smad3/TGF-β1 and Smad3/p38 MAPK pathways

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
α-SMA AGGAGCAAAATCTGTCCGATCT GTGGGGGAATTATCTTTCCTGG
Vimentin TGAATGACCGCTTCGCCAACTAC CTCCCGCATCTCCTCCTCGTAG
TGF-β1 ACCTCGGCTGGAAGTGG CCGGGTTATGCTGGTTGT
p38MAPK TTACCGATGACCACGTTCAGTTTC AGCGAGGTTGCTGGGCTTTA
GAPDH GGCACAGTCAAGGCTGAGAATG ATGGTGGTGAAGACGCCAGTA
β-actin CTACCTCATGAAGATCCTCACCGA TTCTCCTTAATGTCACGCACGATT