Skip to main content

Table 1 Primers used for analysis of mtDNA copy number or HT22 cells gene expression by Q-PCR

From: Intake of flavonoids from Astragalus membranaceus ameliorated brain impairment in diabetic mice via modulating brain-gut axis

Gene Forward primers (5′ to 3′) Reverse primers (5′ to 3′)
β-actin CTACCTCATGAAGATCCTGACC CACAGCTTCTCTTTGATGTCAC
RAGE CTACCTTCTCCTGCAGTTTCAG CATCCTTTATCCAGTGGACCTG
BDNF GATGCCGCAAACATGTCTATG A TAATACTGTCACACACGCTCAGCTC
Cox3 TTTGCAGGATTCTTCTGAGC TGAGCTCATGTAATTGAAACACC
Ndufv1 CTTCCCCACTGGCCTCAAGC CCAAAACCCAGTGATCCAGC
  1. β-actin, beta-actin; RAGE, advanced glycosylation end product-specific receptor; BDNF, brain derived neurotrophic factor; Cox3, cytochrome c oxidase subunit 1; Ndufv1, NADH dehydrogenase (ubiquinone) flavoprotein 1