Skip to main content

Table 1 Primer sequence for RT-qPCR

From: Liushen Capsules, a promising clinical candidate for COVID-19, alleviates SARS-CoV-2-induced pulmonary in vivo and inhibits the proliferation of the variant virus strains in vitro

Target gene Direction Sequence (5′-3′)
IFN-α (mouse) Fwd ACTCATTCTGCACTGGCCTCCA
  Rev ACTTCTGCTCTGACCACCTCCC
IFN-γ (mouse) Fwd TGACATGAAAATCCTGCAGAGCC
  Rev GCTGGACCTGTGGGTTGTTGAC
IP-10 (mouse) Fwd TGAGGGCCATAGGGAAGCTTGAAAT
  Rev TCCGGATTCAGACATCTCTGCTCAT
MCP-1 (mouse) Fwd AAGATCTCAGTGCAGAGGCTCG
  Rev CCA GGGGTAGAACTGTGGTTCAA
GAPDH(mouse) Fwd CAAAATGGTGAAGGTCGGTGTG
  Rev GTTGAGGTCAATGAAGGGGTCG
IL-6 (human) Forward CGGGAACGAAAGAGAAGCTCTA
  Reverse CGCTTGTGGAGAAGGAGTTCA
CCL-5 (human) Forward CAGCAGTCGTCTTTGTCACC
  Reverse GTTGATGTACTCCCGAACCC
IL-8 (human) Forward CTTGGTTTCTCCTTTATTTCTA
  Reverse GCACAAATATTTGATGCTTAA
IP-10 (human) Forward GAAATTATTCCTGCAAGCCAATTT
  Reverse TCACCCTTCTTTTTCATTGTAGCA
IL-1α (human) Forward GAAGATGTGCCTGTCCTGTGT
  Reverse CGCTCAGGTCAGTGATGTTAA
MIP-1α (human) Forward CTGCATCACTTGCTGCTGACA
  Reverse CACTGGCTGCTCGTCTCAAAG
GAPDH(human) Forward GAAGGTGAAGGTCGGAGTC
  Reverse GAAGATGGTGATGGGATTTC