Skip to main content

Table 1 Primer sequences used for real-time PCR

From: Puerarin promotes osteogenesis and inhibits adipogenesis in vitro

Gene Forward primer Reverse primer
M-β-actin TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
M-C/ebpα GAACAGCAACGAGTACCGGGTA GCCATGGCCTTGACCAAGGAG
M-Pparγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
M-Fabp4 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
M-Lpl GGGAGT TTGGCTCCAGAGTTT TGTGTCTTCAGGGGTCCTTAG