Skip to main content

Table 1 Sequence of primers used in real-time PCR

From: A novel coumarin, (+)-3′-angeloxyloxy-4′-keto-3′,4′-dihydroseselin, isolated from Bupleurum malconense (Chaihu) inhibited NF-κB activity

Gene Primer Sequence (5′–3′)
iNos Sense CACCTTGGAGTTCACCCAGT
Antisense ACCACTCGTACTTGGGATGC
Tnf-α Sense CTGTGAAGGGAATGGGTGTT
Antisense GGTCACTGTCCCAGCATCTT
Il- Sense GCTGAAGGAGTTGCCAGAAA
Antisense GTGCAAGTGACTCAGGGTGA
β-Actin Sense GGTGAAGGTCGGTGGAACG
Antisense CTCGCTCCTGGAAGATGGTG