Skip to main content

Table 2 Descriptions of the 14 candidate reference genes and their primer sequences for qRT-PCR

From: Selection and validation of reference genes for normalization of quantitative real-time reverse transcription PCR analysis in Poria cocos (Schw.) Wolf (Fuling)

Gene Gene description Primer sequences (forward/reverse) Amplicon length (bp) Access number Total copy numbers
GAPDH Glyceraldehyde 3-phosphate dehydrogenase TGTTCGTCTGCGGTGTCA/AGTGGACGGTGGTCATCAG 150 KJ716556 1
MAPK Mitogen-activated protein kinase CACATCCAGCACGAGAACAT/GGAGGATCTGGTAGAGGAAGTA 163 KJ716546 10
β-Act Beta actin ATGCGAGGTTATGCGTTCA/CCGACCATCTGGGAGTGTAT 156 KJ716554 2
RPB2 RNA polymerase subunit 2 ACCAACTTCCTCGTCAGAATG/TCCTGATTGTATCCGCTGTAAC 161 KJ716552 1
RPB1-1 RNA polymerase subunit 1 GGCTTACAACAGGTCGTCAA/CGTGGCGTCCTCAATAACTT 153 KJ716547 2
RPB1-2 RNA polymerase subunit 1 AGGATGACGAAGCAGAGGAA/TGGCATTGGGCAGGTTCT 168 KJ716548
his3-1 Histone 3 AGTCCACGGAACTCCTAATCA/AGCGGCTAAGTTGGTGTCT 167 KJ716557 3
his3-2 Histone 3 CGACGGAGTTGCTCATCAG/GTGGATCGCAGCCAGATTC 170 KJ716544
APT Adenine phosphoribosyltransferase ACCTGAGGAGTCTGCTGAAG/TTGTGGAATAGTGTGCGATGT 149 KJ716549 1
SAMDC S-adenosylmethionine decarboxylase GCTTCTACTCTCGCAAGGC/GATATACAGCAGCCAGTGGTC 155 KJ716550 1
RP Ribosomal protein TGTCGCTCTCCTCAAGTCC/CGGAATGCCTTGACGATACC 165 KJ716551 1
β-Tub Beta tubulin GCCAACATACGGTGATCTGAA/GAAGAAGTGAAGACGAGGGAAT 142 KJ716555 1
EIF Eukaryotic translation initiation factor TGACGATGACAGCGATGAAG/CACCTGGACTGCCTTATGC 145 KJ716545 1
CYP Cyclophilin CATGGCTTCGGCTACAAGG/TTGGTGTGCTTGAGCTTGAA 152 KJ716553 3