Skip to main content

Advertisement

Table 2 Oligonucleotide primers used for molecular identification

From: An investigation of fungal contamination on the surface of medicinal herbs in China

Primer name Primer sequence Amplification product (bp) Annotation Gene targeted
Wen1-F 5′–TCCAACCTCCCACCCGTGTTTA–3′ 400 This study ITS1-5.8S-ITS2
Wen1-R 5′–AAGCCCCTACGCTCGAGGA–3′
ITS1 5′–TCCGTAGGTGAACCTGCG–3′ 500 ~ 700 [32]
ITS4 5′–TCCTCCGCTTATTGATATGC–3′