Skip to main content

Advertisement

Table 1 Primer sequences used for RT-PCR

From: Metabolomics combined with network pharmacology exploration reveals the modulatory properties of Astragali Radix extract in the treatment of liver fibrosis

Gene Forward Reverse
CYP1A2 GTGGTGGAATCGGTGGCTAATGTC CTTGCTGCTCTTCACGAGGTTGAG
CYP1B1 CGAGAGTTGGTGGCAGTGTTGG CTCGGCATCGTCGTGGTTGTAC
PCYT1A AGACGAGGTGGTGAGGAACGC TGGAGATGCCTTCTGTCCTCTGTG
α-SMA GGCCACTGCTGCTTCCTCTTC TGCCCGCCGACTCCATTCC
TGF-β1 ATGGTGGACCGCAACAACGC CTGGCACTGCTTCCCGAATGTC
GAPDH GTCCATGCCATCACTGCCACTC GATGACCTTGCCCACAGCCTTG