Skip to main content

Table 1 Specific primers for quantitative RT-PCR

From: Protective effects of essential oil from Fructus Alpiniae zerumbet on retinal Müller gliosis via the PPAR-γ-p-CREB signaling pathway

GeneForwardReverse
PPAR-γCGATGCTGTCCTCCTTGATGGCAGAATGGCTTCCTCAGGT
VEGFCGGAGAGCAACGTCACTATGGGTCTGCATTCACATCTGCT
GFAPCCTGAGGCAGAAGCTCCAAGAGATCCACACGAGCCAAGGT
β-ActinTGTCACCAACTGGGACGATAGGGGTGTTGAAGGTCTCAAA