Skip to main content

Table 1 Primers sequences used for real-time PCR

From: Luo Tong formula attenuates retinal inflammation in diabetic rats via inhibition of the p38MAPK/NF-κB pathway

GenesForward primerReverse primerSize (bp)
IL-1β5′CCCTGCAGCTGGAGAGTGTGG3′5′ACCAGTTGGGGAACTGTGCAGAC3′126 bp
MCP-15′GGCCAGCCCAGAAACCAGCC3′5′ACTGCATCTGGCTGAGACAGCAC3′136 bp