Skip to main content

Table 1 The primers for the quantitative RT-PCR

From: Corydalis saxicola Bunting total alkaloids attenuate paclitaxel-induced peripheral neuropathy through PKCε/p38 MAPK/TRPV1 signaling pathway

Gene Forward primer Reverse primer
TRPV1 AGAAGGGGAACCAGGGCAAAG TCAACGAGGACCCAGGCAACT
PKC epsilon TCTGGAAGCAGCAATAGAGTT TCATCAAGGTGTTAGGCAAAG
Tac1 CTCACAAAAGGCATAAAACAGATT TGAATAGATAGTGCGTTACAGGGTT
CGRP GTCCCTCCTCTCCTTTCCAGTT AGATTCCAGATACCATCCTTTGCC
PGE2 AGGGAGCATACAGCGAAGGTG TGCGGATTGTCTGGCAGTAGC
TNF-α GCGTGTTCATCCGTTCTCTACC TACTTCAGCGTCTCGTGTGTTTCT
β-actin ATCATTGCTCCTCCTGAGCG CGCAGCTCAGTAACAGTCCG