Skip to main content

Table 1 The PCR primers of osteogenic and angiogenic genes

From: Improvement of polydopamine-loaded salidroside on osseointegration of titanium implants

Genes Forward primer (5′–3′) Reverse primer (5′–3′)
Mouse GAPDH CCCTTAAGAGGGATGCTGCC ACTGTGCCGTTGAATTTGCC
RUNX2 TTCGCCTCACAAACAACCAC AACAAAACAAAACGGAGTGAGC
OCN GAACAGACAAGTCCCACACAGC TCAGCAGAGTGAGCAGAAAGAT
ALP GCAGTATGAATTGAATCGGAACAAC ATGGCCTGGTCCATCTCCAC
Human GAPDH GAAAGCCTGCCGGTGACTAA TTCCCGTTCTCAGCCTTGAC
HIF-1α ACGTTCCTTCGATCAGTTGTCACC GGCAGTGGTAGTGGTGGCATTAG
MMP-2 CAGGACATTGTCTTTGATGGCATCGC TGAAGAAGTAGCTATGACCACCGCC
ROCK1 AGCCTACAGATCACTAGCAAT TGTGGTACTGATGCTCTCCACG
VEGF ATCGAGTACATCTTCAAGCCAT GTGAGGTTTGATCCGCATAATC