Skip to main content

Table 2 Primer sequences for qRT-PCR

From: Effect of traditional chinese medicine (TCM) and its fermentation using Lactobacillus plantarum on ceftriaxone sodium-induced dysbacteriotic diarrhea in mice

Gene Primer sequences (5′→3′) Product (bp) Accession no.
GAPDH Forward: TGTGGATCAGCAAGCAGGAG
Reverse: ACGCAGCTCAGTAACAGTCC
87 NM_001289726.1
AQP1 Forward: TTCCTGGTCTCAGAGCTTCC
Reverse: TGGGTCCCTCACTTTCACTC
91 NM_007472.2
AQP3 Forward: CTTGTGATGTTTGGCTGTGG
Reverse: AAGCCAAGTTGATGGTGAGG
85 NM_016689.2
AQP4 Forward: GTGTCTGTGGCAGCGAGATA
Reverse: GCATCTGCCTCAGAACATGA
116 NM_001308641.1
ZO-1 Forward: TTCAGCAGCAACAGAACCAG
Reverse: CGATCGTCATGCAAATCAAG
88 XM_006540786.4
Occludin Forward: GAATGGCAAGCGATCATACC
Reverse: CTGCCTGAAGTCATCCACAC
106 NM_001360536.1