Skip to main content

Table 1 Primers used for marker analysis

From: Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima

Technique Annealing temperature (°C) Name of the primer Sequence Number of polymorphic bands Marker
length (kb)
RAPD 35-40 S62 GTGAGGCGTC 1 0.6
  S343 TCGTGCGGGT 2 0.9,1.1
SCAR 55-60 SR-S343-F1 CTCTTGAGCAATCCAAATGTTTTGTTATCA   
  SR-S343-R1 CATAAATCACTTTATAACATAACGAGCTCGTATT 1 1.03
  SR-S343-R2 CGCGACAGAGGGGTTTTCTTTCTATTA 1 0.95
  SR-S343-R3 AGACGCCTCACTTTGATAGACATGAGTTTA 1 0.89
SNP 50-60 Sn-S62-a CGACAGTAAACATAAAAACCG 1 1*
  Sn-S62-b CTGTTACCATTGGCTCTTTACC   
CAPS 60-67 CP-S62-f TCGTGCGGGTCATAGTACCCCGAGACAAGAGGCCAAAA 2 0.25, 0.3 (Afl III)
  CP-S62-r TGTAATACGAAAGTTTAAGTCTCTTTTCTTAGTC   0.2, 0.35 (Drd I)
  1. * Only one base with different colors. The fluorescent dyes are assigned to the individual ddNTPs. Each ddNTP is labeled with a different color, ddATP green, ddCTP blue, ddGTP black, and ddTTP red.