Skip to main content

Advertisement

Table 1 mRNA and lncRNA primers for quantitative PCR analysis

From: Baduanjin exerts anti-diabetic and anti-depression effects by regulating the expression of mRNA, lncRNA, and circRNA

Primer name Sequence
β-actin (H) F: “5′ GTGGCCGAGGACTTTGATTG 3′” R :“5′ CCTGTAACAACGCATCTCATATT3′”
CXCL8 F: “5′ CATACTCCAAACCTTTCCACC 3′” R : “5′ ACTTCTCCACAACCCTCTGC 3′”
CXCR4 F: “5′ ATAAAATCTTCCTGCCCACC 3′ R : “5′ TACTTGTCCGTCATGCTTCTC3′”
DUSP2 F: “5′ TTTTCCGCTACAAGAGTATCCC 3′” R : “5′ CACCCAGTCAATGAAGCCTAT 3′”
IL1B F: “5′ CCGACCACCACTACAGCAAG 3′” R : “5′ TGGACCAGACATCACCAAGC 3′”
NR4A2 F: “5′ CAGTGGAGGGTAAACTCATCTT 3′” R : “5′ TTCCTTGAGCCCGTGTCT 3′”
OSM F: “5′ CTGCTCGAAAGAGTACCGC 3′” R : “5′ GCCCAGTGTGGCATTGAG 3′”
NEAT1 F: “5′GCTGCATCTTCTAAATTGAGCC 3′” R: “5′GCAAACAGGTGGGTAGGTGAG 3′”