Animals
A total of 80 eight-week-old male C57BL/6 mice (weighing 20–25 g) were used in this study. All animals were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. Half of the mice were randomly divided into four groups (control, TNBS, EA, and sham EA). The other mice were randomly divided into four groups (control + vectors, TNBS + vectors, control + P2Y12 shRNA, TNBS + P2Y12 shRNA). All animals were housed in cages with a 12 h light/dark cycle and were given free access to food and water. Mice were housed under a controlled environment at a constant temperature of 22–25 °C and humidity of 50 ± 10%.
P2Y12 shRNA treatment
We amplified the shRNA coding sequence of P2Y12 by reverse transcription polymerase chain reaction and ligated it into the GV493 plasmid to generate LV-P2ry12-RNAi (Shanghai Genechem Co., Shanghai, China), and LV-GFP was used as a control. The titer of the lentivirus was 1 × 109 titer units (Tu)/ml. ShRNA injections were performed three weeks before modeling. Mice were anesthetized with 10 ml/kg intraperitoneal injection of pentobarbital and fixed on a stereotaxic apparatus (RWD Instruments, China). After disinfection, the bregma and lambda points were exposed, and the balance was corrected. The coordinates were set according to the mouse brain atlas, and holes were drilled on the skull with a dental drill. Desired viral vectors were injected into the bilateral mPFC (AP: + 2.0 mm, ML: ± 0.4 mm, DV: -2.4 mm) using a microsyringe (1 μl, Hamilton, NV, USA) with a glass electrode attached to the front end. Injection occurred at a speed of 30 nl/min. P2Y12 shRNA sequence: GGTCTAGTTTGGCACGAAA and empty virus sequence: TTCTCCGAACGTGTCACGT.
TNBS-induced IBD mice
The day before modeling, the mice were kept in a fasting and water-only environment. The mice were anesthetized with 80 mg/kg pentobarbital (20% ethanol) administered intraperitoneally. TNBS was obtained from Sigma–Aldrich, St. Louis, MO, USA. A PVC-Fr4 catheter (Φ2.7 mm, YN Medical Instrument, Yangzhou, China) was inserted at a depth of approximately 4 cm into the anus of the colon, and the other end was connected to a 1 ml syringe. Mice in the TNBS group were injected with 50 μl of TNBS (5% w/v) and 50 μl of absolute ethanol through a catheter to induce IBD [26]. Mice in the control group were injected with 50 μl of absolute ethanol and 50 μl of distilled water. After the lysate was infused, the mice were placed head down for 1 min.
EA treatment
One day after the IBD mice were established, the mice in the EA group were treated with EA. A Han's Acupoint Nerve Stimulator (Hans-200A, Jisheng Medical Technology Co., Ltd., Nanjing, China) was used to stimulate the bilateral "Dachangshu" (BL25) of mice once a day for 7 days. EA was carried out at 1 mA and 2 Hz for 30 min. For the sham EA group, needles were inserted at the same acupoints, but Han's acupoint nerve stimulator was not connected, and no other operations were performed. During EA treatment, the mice were placed into a homemade 10 cm square denim pocket. In the control group and the TNBS group, the mice were put into the pocket without any treatment. During treatment, the mice remained awake and showed no obvious signs of distress.
Mechanical sensitivity test
Mechanical pain was tested with von Frey filaments. Before the test, the mice were placed into the testing environment to adapt for 30 min. Before modeling with TNBS, the mice were tested for mechanical threshold for three days, and the average value was used as the baseline threshold. After the injection of TNBS, the mice were subjected to a nociceptive threshold test after EA treatment for 7 consecutive days. The mechanical threshold was measured by the “up and down” method. The mouse was placed in an organic plastic box with a metal mesh pad at the bottom, and von Frey filaments were used to apply a vertical force to the mouse's left hind paw for 6 s. Lifting the foot or licking was considered a positive response, and the statistics were calculated as the average of two tests performed at a 5-min interval.
Visceral hyperalgesia test
After other behavioral experiments, colorectal dilatation (CRD) was used to evaluate the degree of visceral hyperalgesia, and the abdominal withdrawal reflex (AWR) of the mice was recorded. The scoring standard refers to Al-Chaer's method [27]: no behavioral response to CRD, scored as 0 points; given to stimulated mice with short head or body movements, scored as 1 point; abdominal muscle contraction during stimulation, scored as 2 points; lifted abdomen, scored as 3 points; body arched and the pelvis and scrotum are lifted, scored as 4 points. Before the test, the mice were placed in a plexiglass compartment (20 cm × 20 cm × 10 cm) for 5 min. A children's scalp needle infusion set was used as a catheter. One end of the catheter was connected to the balloon, and the other end was connected to a 10 ml syringe and a blood pressure meter through a three-way joint. The balloon was inserted into the rectum until the catheter was positioned into the anus (2 cm away from the end of the balloon). The catheter was fixed at the bottom of the tail to prevent it from falling off, and the CRD test was performed with stepwise pressure (20/40/60/80 mmHg). Each pressure value was measured twice, lasting 30 s, with an interval of 4 min, and the average value was taken.
Sucrose preference test
Mice were single housed in cages with a water shortage for 6 h and were given two identical water bottles for 24 h, one containing sucrose water (1.5%) and the other containing ordinary water. Twelve hours later, the positions of the two bottles were changed. The weight of the water bottle was recorded before and after the test. A mouse’s preference for sucrose was recorded as sucrose consumption (g)/ (sucrose consumption (g) + water consumption (g)).
Forced swimming test
Mice were placed in a plastic cylinder filled with water to 20 cm from the bottom under usual illumination. The behavior of mice was recorded by a camera. The duration of immobility was counted by the same person during the study as the time when the animals remained floating without any movement of either the head or the four limbs. Only the last 4 min of trials were analyzed.
Tail suspension test
A tape was attached from the tip to a 1–2 cm position on the tail of the mouse, and the mouse was hung at a height of 30 cm on a horizontal rod. A cylindrical plastic tube was placed at the bottom of the tail to prevent the tail from climbing. The mice were suspended for 6 min, and video recordings of quantitative tests were obtained. The total time spent in the stationary posture was measured.
Enzyme-linked immunosorbent assay
IL-1β levels were measured by a Mouse Interleukin 1β (IL-1β) ELISA Kit (Chuangxiang Biological Technology Co., Shanghai, China) as described in the manufacturer’s instructions. The tissues were collected using 0.09% NaCl and then centrifuged for 30 min at 3000 g at 4 °C within 30 min of collection. Ten microliters of testing sample and 40 µl of sample diluent were added to the testing sample well. Then, 50 µl of standard was added to the standard well, and the blank well did not contain anything. Next, 100 µl of HRP-conjugated reagent was added to each well, covered with an adhesive strip and incubated for 60 min at 37 °C. Chromogen solution A (50 µl) and chromogen solution B (50 µl) were added to each well and incubated for 15 min at 37 °C in the dark, and then stop solution was added to each well. A microtiter plate reader was used to read the optical density (O.D.) at 450 nm. The IL-1β concentration in the brain tissues was calculated from standard curves.
Quantitative real-time polymerase chain reaction
Mice were anesthetized, and the mPFC was isolated immediately. Total RNA samples were extracted using TRIzol Reagent (Takara, Shiga, Japan). The PrimeScript PT reagent kit (Vazyme, Nanjing, China) was used to synthesize cDNA. Quantitative real-time PCRs were performed with the SYBR Green Kit (Vazyme, Nanjing, China) using 1 μl of cDNA and 0.2 μl of each primer in a 10 μl final volume. Primers were designed through the National Center for Biotechnology Information using the following sequences: P2Y12, forward primer TCACCCAGGTTCTCTTCCCA, reverse primer CGGCTCCCAGTTTAGCATCA; β-actin, forward primer TGCTGTCCCTGTATGCCTCTG, reverse primer TGATGTCACGCACGATTTCC. The comparative Ct method was used for data analysis.
Western blot
The protein of the collected mouse brain tissues was extracted using cold lysis buffer containing protease inhibitor. The protein concentrations were determined by the bicinchoninic acid (BCA) method (Beyotime Biotechnology, Shanghai, China). Equal amounts of protein from different samples were separated using sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) gels and then electrotransferred onto a 0.45-μm polyvinylidene fluoride (PVDF) membrane (Millipore, USA). After the membrane was immersed in 3% bovine serum albumin (BSA) for 2 h, target proteins were detected using primary antibodies, including rabbit anti-P2Y12R antibody (1:800), rabbit anti-IL-1β antibody (1:800), and rabbit anti-β-actin antibody (1:1000). Horseradish peroxidase (HRP)-conjugated secondary antibodies were incubated at 37 °C for 40 min. Immunoreactive bands on the membrane were visualized by enhanced chemiluminescent detection (Beyotime Biotechnology, Shanghai, China). The relative expression abundance was tested by ImageJ software (NIH, Bethesda, MD, USA).
Immunofluorescence
Animals were anesthetized after the behavioral experiment. The brains were dehydrated for 24 h in 10% sucrose, 20% sucrose and 30% sucrose in succession after postfixation in 4% paraformaldehyde overnight. These samples were cut into 20 μm thick coronal sections and then used for rabbit anti-IBA-1(1:200) or mouse anti-CD68 (1:400) immunohistochemistry staining. Then, the tissues were incubated with secondary antibodies from Jackson ImmunoResearch: donkey anti-rabbit IgG conjugated with donkey anti-rabbit IgG conjugated with DyLight 594 (1:600), and donkey anti-mouse IgG conjugated with donkey anti-mouse IgG conjugated with DyLight 594 (1:400). The reaction product was visualized and captured by a digital fluorescence microscope (Olympus), the percentage of IBA-1-positive cells was quantified by Strata Quest 7.0 and the percentage of CD68-positive area was quantified by ImageJ software.
Statistical analysis
All data are presented as the mean ± SEM. GraphPad Prism 8 software (Inc., La Jolla, CA, USA) was used in this study for data analysis. A t test was used to analyze significant differences between two groups. Ordinary one-way analysis was used, followed by Tukey’s multiple comparisons test. For visceral pain and mechanical sensitivity, two-way multiple comparisons with Bonferroni’s multiple comparisons test were used. A value of P < 0.05 was considered statistically significant.
